Journal: Immunity

Article Title: The cytokine TNF promotes transcription factor SREBP activity and binding to inflammatory genes to activate macrophages and limit tissue repair

doi: 10.1016/j.immuni.2019.06.005

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: CD14 microbeads, human , Miltenyi Biotec , RRID:AB_2665482.

Techniques: Purification, Control, Virus, Plasmid Preparation, Recombinant, Amplex Red Cholesterol Assay, cDNA Synthesis, SYBR Green Assay, Multiplex Assay, RNA Library Preparation, Microarray, Software

Journal: Cell

Article Title: Synergism of TNF-α and IFN-γ Triggers Inflammatory Cell Death, Tissue Damage, and Mortality in SARS-CoV-2 Infection and Cytokine Shock Syndromes

doi: 10.1016/j.cell.2020.11.025

Figure Lengend Snippet:

Article Snippet: L-NAME hydrochloride , TOCRIS , Cat# 0665.

Techniques: Control, Virus, Recombinant, Protease Inhibitor, Western Blot, Multiplex Assay, Enzyme-linked Immunosorbent Assay, Gene Expression, Microarray, Software

Journal: Cell Reports

Article Title: Chromatin accessibility governs the differential response of cancer and T cells to arginine starvation

doi: 10.1016/j.celrep.2021.109101

Figure Lengend Snippet:

Article Snippet: For microarray analysis, RNA was extracted from THP1 or stimulated human CD4+ T cells using the RNeasy Mini kit (QIAGEN).

Techniques: Recombinant, Multiplex sample analysis, Cell Isolation, Activation Assay, Staining, Flow Cytometry, Expressing, Reverse Transcription, Transfection, TA Cloning, Plasmid Preparation, Methylation, Immunoprecipitation, Purification, DNA Library Preparation, Library Quantification, Control, Sequencing, Methylation Sequencing, Amplification, Software

Journal: Neuron

Article Title: Inhibition of Upf2-Dependent Nonsense-Mediated Decay Leads to Behavioral and Neurophysiological Abnormalities by Activating the Immune Response

doi: 10.1016/j.neuron.2019.08.027

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: RNAeasy Plus Universal Mini Kit , QIAGEN , Cat. #: 73404.

Techniques: Recombinant, Sequencing, SYBR Green Assay, Multiplex Assay, Microarray, Knock-Out, Software

Journal: Cell reports

Article Title: EGFR-phosphorylated GDH1 harmonizes with RSK2 to drive CREB activation and tumor metastasis in EGFR-activated lung cancer

doi: 10.1016/j.celrep.2022.111827

Figure Lengend Snippet:

Article Snippet: Human: H1299 cells , ATCC , Cat#CRL-5803; RRID: CVCL_0060.

Techniques: Microarray, Recombinant, Purification, Membrane, SYBR Green Assay, Viability Assay, Phospho-proteomics, Kinase Assay, Reverse Transcription, Transcription Factor Assay, Enzyme-linked Immunosorbent Assay, Multiplex Assay, Extraction, Isolation, shRNA, Sequencing, Plasmid Preparation, Software

Journal: Frontiers in Molecular Biosciences

Article Title: A systematic review of the barcoding strategy that contributes to COVID-19 diagnostics at a population level

doi: 10.3389/fmolb.2023.1141534

Figure Lengend Snippet: Schematic representation of mechanistic strategies of barcoding. (A–C) Barcodes can be introduced to a template using adaptors through direct ligation (A) , using RT- or PCR primers at the reverse transcription or PCR amplification step (B) , and using hybridizing molecular inversion probes (C) . (D) Schematic representation of the difference between “barcodes” and “sample indexes”. Barcodes aim to correct sequencing errors. For example, a misreading nucleotide, guanosine (G) can be corrected in final consensus sequences for a pool of Sample 1 (top panel). Sample indexes are used to multiplex different sequencing amplicons generated from different pools of samples (Sample 1, 2, and 3) (bottom panel). Panel (A) is modified based on in and panel (C) is modified based on in .

Article Snippet: Primer-associated approach , Sequence-based barcodes , SQK-RBK004: transposase carrying barcodes to the site of the cleavage , - , - , Whole genome , Oxford Nanopore Rapid Barcoding kit (SQK-RBK004) , SARS-CoV-2 patient samples (nasopharyngeal swab) , Oxford Nanopore , Guppy version 3.6.0; ARTIC Network bioinformatics protocol , Multiplex samples , Propose a method to sequence the whole genome of SARS-CoV-2 in a rapid and cost-efficient manner , .

Techniques: Ligation, Reverse Transcription, Amplification, Sequencing, Multiplex Assay, Generated, Modification

Journal: Frontiers in Molecular Biosciences

Article Title: A systematic review of the barcoding strategy that contributes to COVID-19 diagnostics at a population level

doi: 10.3389/fmolb.2023.1141534

Figure Lengend Snippet: Systematic comparison of barcoding strategies used in the category of molecular barcodes.

Article Snippet: Primer-associated approach , Sequence-based barcodes , SQK-RBK004: transposase carrying barcodes to the site of the cleavage , - , - , Whole genome , Oxford Nanopore Rapid Barcoding kit (SQK-RBK004) , SARS-CoV-2 patient samples (nasopharyngeal swab) , Oxford Nanopore , Guppy version 3.6.0; ARTIC Network bioinformatics protocol , Multiplex samples , Propose a method to sequence the whole genome of SARS-CoV-2 in a rapid and cost-efficient manner , .

Techniques: Comparison, Software, Sequencing, Multiplex Assay, CRISPR, Plasmid Preparation, Microarray, Binding Assay, Amplification, Extraction, Ligation, DNA Sequencing, Multiplexing, Generated, Reverse Transcription, Staining, Flow Cytometry, High Throughput Screening Assay, Inhibition, Blocking Assay, Conjugation Assay, RNA Sequencing Assay, Transmission Assay, Incubation, Diagnostic Assay, Next-Generation Sequencing, Infection

Journal: Life Science Alliance

Article Title: Inflammatory risk contributes to post-COVID endothelial dysfunction through anti-ACKR1 autoantibody

doi: 10.26508/lsa.202402598

Figure Lengend Snippet: (A) Gene expressions of endothelial antigens upon TNFα (10 ng/ml) treatment on human umbilical artery and vein cells for 24 h. Data represent mean ± s.d.; n = 3 biological replicates; two-way ANOVA; * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001. (B) Flow cytometry analysis of ACKR1 protein expression on artery and vein cells after 48 h of stimulation with TNFα (10 ng/ml). Data represent mean ± s.d.; n = 3 biological replicates; two-way ANOVA; **** P < 0.0001. (C) Expression profile of Ackr1 in vascular endothelial subtypes of various organs from a mouse single-cell transcriptome atlas (accession code: E-MTAB-8077 ). Data were generated with EC Atlas web-based visualization.

Article Snippet: We custom made a microarray-based autoantibody detection kit (RayBiotech) where a glass slide surface was spotted with purified human recombinant ACKR1 protein (Cat #TP304680; OriGene) that could be recognized by ACKR1 autoantibodies present in human plasma.

Techniques: Flow Cytometry, Expressing, Generated

Journal: Life Science Alliance

Article Title: Inflammatory risk contributes to post-COVID endothelial dysfunction through anti-ACKR1 autoantibody

doi: 10.26508/lsa.202402598

Figure Lengend Snippet: (A) Scatterplot of the plasma levels of anti-ACKR1 autoantibodies in COVID-19 survivors and non-infected controls (mean ± s.e.m., Mann–Whitney test). Anti-ACKR1 concentrations were calculated based on normalized ratio over positive control of human immunoglobulin G (50 μg/ml) and presented as fold change to non-infected controls. (B) Heatmap depicting plasma concentrations of anti-ACKR1 autoantibodies, cytokines (quantified by Luminex multiplex assay), and enumeration of circulating endothelial cells in COVID-19 survivors and non-infected controls. Spearman’s correlation analysis revealed positive associations between anti-ACKR1 levels and the quantity of circulating endothelial cells, as well as each cytokine listed, with significant P -values indicated. Heatmap was generated using the MORPHEUS visualization software. (C) Spearman’s correlation analysis between anti-ACKR1 levels and reactive hyperemia index in individuals (n = 10) with endothelial dysfunctions (characterized by natural log-transformed reactive hyperemia index < 0.51). Spearman’s correlation coefficient r and P -values (two-tailed test) are indicated. (D) Kaplan-Meier plot shows the probability of primary vascular disease outcomes in patients without prior established cardiovascular diseases in a median follow-up period of 6.7 yr. Hazard ratio and 95% confidence intervals (CI) compare the time of blood collection to the first occurrence of vascular outcomes according to the presence of anti-ACKR1 autoantibodies (n = 16 undetectable anti-ACKR1, n = 10 anti-ACKR1 > 0 μg/ml).

Article Snippet: We custom made a microarray-based autoantibody detection kit (RayBiotech) where a glass slide surface was spotted with purified human recombinant ACKR1 protein (Cat #TP304680; OriGene) that could be recognized by ACKR1 autoantibodies present in human plasma.

Techniques: Infection, MANN-WHITNEY, Positive Control, Luminex, Multiplex Assay, Generated, Software, Transformation Assay, Two Tailed Test

Journal: Life Science Alliance

Article Title: Inflammatory risk contributes to post-COVID endothelial dysfunction through anti-ACKR1 autoantibody

doi: 10.26508/lsa.202402598

Figure Lengend Snippet: (A) Scatterplot of the plasma levels of anti-ACKR1 autoantibodies in COVID-19 survivors and non-infected controls (mean ± s.e.m., Mann–Whitney test). Anti-ACKR1 levels were determined based on flow cytometry detection of bound anti-ACKR1 to K562 cells, a human erythroleukemic cell line ectopically overexpressing ACKR1. (B) ACKR1 (DARC) polymorphism, G125A (rs12075) was genotyped to identify individuals carrying FYA (G125) and FYB (125A) alleles, indicated under “Observed Frequencies.” “Expected frequencies” were extracted from literature as a comparison. (C) Spearman’s correlation analysis to assess the associations between the circulating levels of anti-ACKR1 autoantibodies and red blood cell count (n = 46).

Article Snippet: We custom made a microarray-based autoantibody detection kit (RayBiotech) where a glass slide surface was spotted with purified human recombinant ACKR1 protein (Cat #TP304680; OriGene) that could be recognized by ACKR1 autoantibodies present in human plasma.

Techniques: Infection, MANN-WHITNEY, Flow Cytometry, Comparison, Cell Counting

Journal: Life Science Alliance

Article Title: Inflammatory risk contributes to post-COVID endothelial dysfunction through anti-ACKR1 autoantibody

doi: 10.26508/lsa.202402598

Figure Lengend Snippet: (A) Experimental workflow of intervening autoantibody-antigen interactions to investigate the functional impact of anti-ACKR1 autoantibodies on human endothelial cells. The three-dimensional structure of ACKR1 was produced using I-TASSER server. (B) Flow cytometry analysis of the percentage of necrotic and late apoptotic endothelial cells after 24 h of experimental treatments. (C) Transendothelial electrical resistance assay to evaluate endothelial barrier permeability after experimental treatments. (D) Number of transmigrated PBMCs in an endothelial-immune cell co-culture transwell assay. (E) Degree of cytotoxicity was determined by quantifying lactate dehydrogenase activity in cell-free supernatants obtained from endothelial cells cultured with purified immunoglobulin G (IgG) and/or PBMCs. (F) Degree of antibody-dependent cellular cytotoxicity was determined from endothelial cells exposed to purified IgG and PBMCs. Purifie IgG was pre-incubated with and without blocking peptide or liposome ACKR1. For (B, C, D, E, F), data represent mean ± s.d.; one-way ANOVA; * P < 0.05, ** P < 0.01; *** P < 0.001, **** P < 0.0001; ns, non-significant. Data points represent biological replicates.

Article Snippet: We custom made a microarray-based autoantibody detection kit (RayBiotech) where a glass slide surface was spotted with purified human recombinant ACKR1 protein (Cat #TP304680; OriGene) that could be recognized by ACKR1 autoantibodies present in human plasma.

Techniques: Functional Assay, Produced, Flow Cytometry, Permeability, Co-Culture Assay, Transwell Assay, Activity Assay, Cell Culture, Purification, Incubation, Blocking Assay

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Participating Teams, Utilized Platforms, Number and Names of Genes or Gene Combinations Used, the Origin of Calibration Samples, and Further Details

Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

Techniques: Generated

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

Techniques: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Red Blood Cell Lysis, Control, Concentration Assay, Sequencing, cDNA Synthesis, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: The Table Depicts Team Contributions (from Left to Right) Regarding Employed Genes, Reported Dose Estimates per Reference Sample 1–3, Differences among Reported and Reference Dose-Values as well as the Summed Absolute Difference over all Reference Samples (SAD), a Correct (Yes) or Incorrect (No) Order of Dose Estimates (from Lowest to Highest) Corresponding to Three Dose Categories [Unexposed, Low (1.2 Gy) and Highly Exposed (3.5 Gy)], the Use of FDXR Gene Expression Changes for dose estimation, as well as the Report Time

Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

Techniques: Gene Expression